1
Documentation du UX de Retro
Typologie des
livres et actes
1. Ancienne prod : Livres HTML (complet)
nb : 4
2. Transition : Livre Pdf (minimal)
nb : 1
3A. Prod actuelle : Livres Pdf (minimal)
nb : 5
3B. Prod actuelle : Actes Pdf (minimal)
nb : 6
4. Autres cas : Sites externes en HTML
nb : 2
5. Autres cas : Livre PDF en 3 parties
nb : 1
6. Collection d’actes
nb :
7 collections,
60 actes
Équivalences avec la
section des revues
Revue
Collection d’actes d’une Association ou d’un éditeur
Livre,
ActeS
Chapitre,
Article de colloque
Numéro
Article
)
(
= 1 ISBN
= 1 PDF
= Col-lection
Fiche Solr XML pour un chapitre
<?xml version="1.0" encoding="UTF-8"?>
<add>
<doc>
<field name="ID">000207co</field>
<field name="ISBN">978-2-9810223-0-1</field>
<field name="ISBNNum">978-2-9810223-1-8</field>
<field name="Corpus_fac">Actes</field>
<field name="AnneePublication">2007</field>
<field name="Fonds_fac">Érudit</field>
<field name="TypePublication_fac">Actes</field>
<field name="Titre_en">Using DNA Microarrays for Assessing Crystal Protein Genes in <marquage typemark="italique">Bacillus thuringiensis</marquage></field>
<field name="Auteur_fac">Luke Masson</field>
<field name="AuteurNP_fac">Masson, Luke</field>
<field name="Affiliation_idx">National Research Council of Canada, Biotechnology Research Institute, Montreal, Quebec, Canada, H4P 2R2. Corresponding author. Mailing address : National Research Council of Canada, Biotechnology Research Institute, 6100 avenue Royalmount, Montreal, Quebec, Canada, H4P 2R2. Tel: 514-496-6150. Fax: 514-496-6312. Email: luke.masson@cnrc-nrc.gc.ca</field>
<field name="Auteur_fac">Jarek Letowski</field>
<field name="AuteurNP_fac">Letowski, Jarek</field>
<field name="Affiliation_idx">National Research Council of Canada, Biotechnology Research Institute, Montreal, Quebec, Canada, H4P 2R2</field>
<field name="Auteur_fac">Alejandra Bravo</field>
<field name="AuteurNP_fac">Bravo, Alejandra</field>
<field name="Affiliation_idx">Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250</field>
<field name="Auteur_fac">Roland Brousseau</field>
<field name="AuteurNP_fac">Brousseau, Roland</field>
<field name="Affiliation_idx">National Research Council of Canada, Biotechnology Research Institute, Montreal, Quebec, Canada, H4P 2R2</field>
<field name="TitreCollection_fac">Proceedings of the 6<exposant>th</exposant> Pacific Rim Conference on the Biotechnology of <marquage typemark="italique">Bacillus thuringiensis</marquage> and its Environmental Impact</field>
<field name="TitreContexte_fac">Proceedings of the 6<exposant>th</exposant> Pacific Rim Conference on the Biotechnology of <marquage typemark="italique">Bacillus thuringiensis</marquage> and its Environmental Impact</field>
<field name="Editeur">Biocontrol Network of Canada - Réseau Biocontrôle du Canada</field>
<field name="Annee">2005</field>
<field name="NombrePage">3</field>
<field name="PremierePage">28</field>
<field name="DernierePage">30</field>
<field name="URLDocument">http://www.erudit.org/livre/pacrim/2005/000207co.pdf</field>
<field name="Langue">en</field>
<field name="MIMEType">application/pdf</field>
<field name="TexteIntegral">
Using DNA Microarrays for Assessing Crystal Protein Genes in Bacillus thuringiensis
Luke Masson1*, Jarek Letowski1, Alejandra Bravo2, and Roland Brousseau1
1 National Research Council of Canada, Biotechnology Research Institute, Montreal, Quebec, Canada, H4P 2R2
2 Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250.
Keywords: cry Array, microarray, cry genes, hybridization
A DNA microarray (cryArray) was designed to identify cry gene contents of Bacillus thuringiensis (Bt) strains. A consentaneous approach was used in which multiple DNA cry-specific probes must all produce a positive hybridization signal to confirm a cry gene’s presence. The immobilized cry-specific oligonucleotide probes agreed with the cry contents of known or PCR-validated Bt strains. In one strain, the cryArray was able to detect the presence of a novel cry1I gene. Since the cryArray can replace hundreds of individual PCR reactions, it should become a valuable tool for fast screening of new Bt isolates presenting interesting insecticidal activities.
Although many Cry proteins are structurally and functionally similar, the diversity of Cry toxins and their insecticidal spectra is immense. More than 280 different Cry toxins are organized into 46 primary ranks based on amino acid similarities (1). Cry1 toxins are the largest and best known family having over 130 entries in the Cry databank. Since many Bt strains typically harbor one to nine cry genes, some of which are known to be cryptic (2), it is clear that to assess the complete cry gene content of unknown Bt strains, a technology possessing good parallel processing capabilities is required. Since DNA microarrays possess this ability to simultaneously hybridize with thousands of different genes, a cry gene microarray (cryArray) was designed which contained cry1 gene-specific oligonucleotides, each spotted and immobilized in triplicate. Various other cry gene primary ranked classes were also included (Fig. 1).
All oligonucleotides were spotted in triplicate (horizontally). The dotted box on the left represents primary ranked cry genes. The dashed box on the right represents the different secondary ranked cry1 gene families. Hybridizations performed with 750 nags (5 ng/mm2) of Cy5-labeled amplified genomic DNA gave sufficiently clear results by producing strong fluorescent signals. The array was constructed using a consentaneous approach so that the presence of any given gene is confirmed only if all the secondary rank probes and all higher rank probes targeting different regions within the gene produced positive hybridization signals. Initial hybridizations were carried out using well-characterized laboratory or commercial Bt single gene strains (HD-73 or Bt subsp. kenyae; cry1Ac or cry1E). Known multi-gene strains (HD-1 or HD-133) were subsequently used to validate this approach (data not shown).
By creating a series of family primers, the cryArray also possessed the ability to detect unknown gene variants within a particular family. An illustration of this is provided in Fig. 2. In this case, the cry1I family primers (secondary ranked) produced a positive hybridization signal from genomic DNA of an unknown Bt strain (IB360) obtained from a Mexican culture collection (3), yet all of the tertiary oligonucleotide probes were negative. The family primers were used to amplify the gene which was sequenced and confirmed to be a novel cry1I gene. As shown in Fig. 3, sufficient homology existed to the family primers to result in positive hybridization signals, whereas, apart from one of two cry1Ia probes, insufficient similarity at the tertiary level resulted in negative signals.
By adding oligonucleotide probes to those present on the existing cryArray, probing the array with fluorescently labeled DNA-free RNA allowed the determination of cry gene expression (Fig. 4). Figure 4 shows all three cry1A genes producing positive signals with Cy-5 labeled mRNA, whereas the DNA cry gene detection probes remained negative.
In conclusion, we found that DNA microarrays can generally provide single oligo cry gene discrimination down to the secondary rank but that a consentaneous or ‘multiple oligo’ approach is needed to achieve discrimination down to the tertiary rank level. Finally, by incorporating complementary oligonucleotide probes, cry gene activity (expression) could be monitored by direct RNA labeling which allows discrimination between active versus cryptic or disrupted genes.
References
1. Crickmore, N. 2006 Full list of delta-endotoxin. URL: http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html. Accessed Feb. 2006.
2. Masson, L., M. Erlandson, M. Puzstai-Carey, R. Brousseau, V. Juárez-Pérez, and R. Frutos. 1998. A holistic approach for determining the entomopathogenic potential of Bacillus thuringiensis strains. Appl. Environ. Microbiol. 64:4782-4788.
3. Bravo, A., S. Sarabia, L. Lopez, H. Ontiveros, C. Abarca, A. Ortiz, M. Ortiz, L. Lina, F. J. Villalobos, G. Peña, M.-E. Nuñez-Valdez, M. Soberón, and R. Quintero. 1998. Characterization of cry genes in a Mexican Bacillus thuringiensis strain collection. Appl. Env. Microbiol. 64:4965-4972.
* Corresponding author. Mailing address : National Research Council of Canada, Biotechnology Research Institute, 6100 avenue Royalmount, Montreal, Quebec, Canada, H4P 2R2. Tel: 514-496-6150. Fax: 514-496-6312. Email: luke.masson@cnrc-nrc.gc.ca
FIG. 1. cryArray key of the tertiary cry1 genes.
FIG. 2. Scanned image of microarrays hybridized with Cy5-labeled genomic DNAs from B. thuringiensis strain IB360. Probes belonging to the same cry gene target are grouped inside the individual squares.
IB360 tattgcgggtaaaatacttggCaccctaggcgttccttttgcaggacaag
cry1Ia tattgcgggtaaaatacttggTaccctaggcgttccttttgcaggacaag
IB360 tattCccaagctatgatacacTTGtAtatccaattaaaactacTTcTca
cry1Ia tattTccaagctatgatacacAAAtGtatccaattaaaactacAGcCca
IB360 gGgttgatttTcattggaaattCGTcacAcATccGatCgcatctgataat
cry1Ib gAgttgatttCcattggaaattTCCcacGcTAccAatAgcatctgataat
IB360 aacacAAgGgcTaggagtgtTgtcaagaGccaatatatcgcattagaaT
cry1Ib/c aacacTCgAgcGaggagtgtAgtcaagaAccaatatatcgcattagaaC
IB360 cgtacaaatacaattgagccaaatagcattacacaaataccattagtaaa
cry1I general cgtacaaatacaattgagccaaatagcattacacaaataccattagtaaa
IB360 agatAtaccaattccatacgtcaattaacggtaaagctattaatcaaggta
cry1I general agatTtaccaattccatacgtcaattaacggtaaagctattaatcaaggta
FIG. 3. Sequence comparison of the cry1I amplicon from Bt strain IB360 to cry1I-specific immobilized cryArray probes. Differences between the cry1I gene amplified from strain IB360 and the immobilized specific secondary or tertiary cry1I-derived gene sequence are shown in large, boldfaced capital letters.
FIG. 4. Partial image of a cryArray hybridized with total RNA from Bt strain HD-1. The white box on the left contains negative strand-specific oligonucleotides normally used to detect cry1Aa, b and c genes. The probes on the right represent complementary probes to the cry1A genes on the left.
</field>
</doc>
</add>
2
Proposition
pour www
Deux Navigations
un livre et ses chapitres,
ou des actes et leurs chapitres :
une collection d’actes :
0. accueil d’erudit.org
1. index
2. table des matières
3. chapitre
0. accueil d’erudit.org
1. index
2. Liste des titres
3. table des matières
4. chapitre
Maquette interactive
TODO
?
Nettoyage des répertoires et fichiers sources (ID *co et *li)
Inclure dans Fedora ou non ?
...
Fermer Livres et actes dans retro, rediriger les URLs
Repenser la terminologie et les libellés
Intégration (avec templates actuels de www)
...
...
Valider et ajuster les maquettes !
3
FEEDBACK ?
Références
Merci !
Refonte : livres et actes
By eruditorg
Refonte : livres et actes
Présentation des maquettes de la section livres et actes
- 715